5cense

387 A Short History of Decay -dance: our biographical odyssey as archival geneography in space + time seeded w/ mitochondrial Eve + capped in sage


«He remembers being born somewhere, having believed in native errors, having proposed principles and preached inflammatory stupidities. He blushes for it ... and strives to abjure his past, his real or imaginary fatherlands, the truths generated in his very marrow. He will find peace only after having annihilated in himself the last reflex of the citizen, the last inherited enthusiasm. How could the heart's habits still chain him, when he seeks liberation from genealogies and when even the ideal of the ancient sage, scorner of all cities, seems to him a compromise? [...] From denial to denial, his existence is diminished: vaguer and more unreal than a syllogism of sighs, how could he still be a creature of flesh and blood? Anemic, he rivals the Idea itself; he has abstracted himself from his ancestors, from his friends, from every soul and himself; in his veins, once turbulent, rests a light from another world.»—E.M. Cioran, from A Short History of Decay

Dear Internet,

Over the past year or so (2013-1014) we've been digitally archiving our photographs. In the process, we've been trying to organize them so we know what's what—where to find something or eliminating redundant ± bad photos. We started down a few paths w/ a few different apps, but in the end settled upon Adobe Bridge + the folder structure we're using is chronological, by year or decade ... + within that chronology we're sorting by place. This seems the best way we've discovered to do this. We can also apply keywords w/ Bridge—for say, names of people, or events or things—so we can then search more specifically. Not only does this help in throwing negatives + paper photographs out (after verifying we have it 1st), but in the long run it will make it easier to browse + find a specific photograph we are looking for ... like that photo of us riding a donkey in Mexico circa 1970 (judging by our pants we were waiting for a flood).

In order to motivate us in this endeavor (cuz we do need it) we're thinking we'll post some of the highlights here on 5¢ense. Apologies in advance, we'll try not to make it too personal ... but mostly this is for our personal reference. What isn't? This is our story, our psychogeographic biography. At some point we might even fold in the journals we kept before we began chronicling our life here on 5¢ense.

Our interest in mining thru old photographs + genealogy is intertwined w/ our interest in language + literature ... our genealogy expressing itself thru language + versa-vice. Not that we're terribly interested in genealogy or have strong ties to our blood line ... to the contrary, we have severed most of those ties + have no intention of propagating our DNA, at least not thru blood. Our intrest lays more in the severance + cauterization of our genetic veins. Working on 'SSES" 'SSES" "SSEY' over the past year is perhaps what instigated this ... our brother-½ had more of an intrest in «where we came from» ... of soul-searching for our father + beyond ...

the author as self-carrying ark or goatherd

Seems the best way to embark on this archival gene-mapping is to go all the way back ... not just decades, or centuries ... but all the way back to when our DNA 1st became human. Last year we swabbed our cheek + sent it into the Genographic Project. We really didn't know what to xpect ... we assumed we were of some sort of mixed mongrel Euromutt heritage, but didn't know for sure what. When we'd ask our dad, he'd say we'd been in America for as long as he or his parents or his parents parents could remember. Same on our mom's side ... tho by virtue of her maiden name (Collins) we assumed mostly Irish (+ the same assumption can be made by our last name—White—that our father came either from the UK or Ireland).

The 1st thing we discovered from our genographic results is that we are 1.5% Neanderthal + 1.5% Denisovan ... which is not saying much. Most non-Africans are around 2% Neanderthal + 2% Denisovan ... so (despite appearances) guess we are a little less Neanderthal than normal.

gratuitous selfie for visual reference of who is this Derek White

+ of course we came from Africa. We all did ... unless you're not human or have your head up your ass + think the garden of Eden is elsewhere. Tho on both sides, our branches were 1 of the 1st to bifurcate out of Africa (~60,000 years ago on our maternal side + ~70,000 years ago on our paternal side). The genographic results are rather vague as u can imagine, the further u go back ... but the more people add to this gene bank + submit known information about their bloodlines, the more accurate the information.

Basically, they have select markers—breadcrumbed mutations—that can trace u back to a certain branch, on both sides. Ends up our maternal branch is J1b1a1. Per our personalized report: «My maternal ancestors carried farming culture from the region of the Fertile Crescent into Europe.» Here's the path they took, heatmapped to show where this branch is most expressed:

+ our paternal branch is R-Z36 ... «My paternal ancestors journeyed into Central Asia. Hunters of megafauna such as the woolly mammoth on the open steppe, they followed their prey with the seasons. Though the big game later became extinct, my cousins still live as nomadic herders in these lands.»

Sounds exotic, but most peeps of European descent probly have similar results. Guess the only real surprise is there's a higher than normal connection w/ western Asia + Russia ... something we had no idea about.

The J branch on our maternal side is not so common. «DNA data indicate that while these new agriculturalists were incredibly successful at planting their technology among the surrounding groups, they were far less successful at planting their own genetic seed. Agriculture was quickly and widely adopted, but the lineages carried by these Neolithic expansions are found today at low frequencies. Your haplogroup has greater diversity in the Near East than in Europe, indicating a homeland for J’s most recent common ancestor around the Levant, a coastal region in what is now Lebanon. It reaches its highest frequency in Arabia, comprising around 25% of the Bedouin and Yemeni.» Go figure, we got Bedouin blood in us.

The final marker on our father's side, U152, has highest frequencies in Belgium (11%), Liechtenstein (33%) + Switzerland (11%).

This is all our «deep ancestry» ... tracking markers back to Mitochondrial Eve + Y-Chromosome Adam. They also compared our DNA to various regions to get a more recent (5,000 — 10,000 years ago) «regional ancestry» that broke down geographically as follows:

Northern European—44%
Mediterranean—37%
Southwest Asian—16%
Northeast Asian—2%.

The «reference populations» most aligned w/ this particular breakdown are:

1. Spain + Portugal
2. Russia

Who would've thunk, judging at least by our surname ... maybe our appellido era Blanco o Белый + they changed it when they picked up + shifted to an Anglo place. Again, this is all relatively in the distant past ... 5,000 to 10,000 years ago. In our next post we'll hone in on more recent genealogical history ... + how we're quite possibly descended from Peregrine White (the 1st «white» (of European descent) person born in America).

+ so we reflect on our past in the present ... November 5, 2014. In our psychological mindset of primal idiocy that that we mentioned in the last post ... of conscious incompetence. Is this all part of our Raft Manifest? What comes after The Becoming? Are we writing our story now?

Speaking of agricultural ancestry ... forgot to mention in the last post the box of garlic + shallots we received from Stanley Crawford.

garlic + shallots from Stanley Crawford's farm

We've been averaging a head or two a day ... last night made habanero salsa w/ roasted garlic + ceviche also w/ plenty garlic ... night before a red sauce w/ linguini + garlic bread.

6.11> ... + how does our geneography relate to ornigraphy? What do we learn from the murmurations of starlings or peregrinations of peregrines? This pilgrimage to retrace the steps of our ancestral pilgrims back to Peregrine White? For our blood supposedly can be traced to Plymouth Rock + to a William White on the Mayflower... our father of fathers.

The fruits of our brother-½'s odyssey is still at the printer. Our better-½'s feeling better ... perhaps all the garlic doing her heart good. No more fluttering.

Thomas De Quincey (who we also mentioned in the last post)—perhaps most famous for his Diary of an English Opium Eater, for giving birth to addiction literature—also had this to say:

«As books multiply to an unmanageable excess, selection becomes more and more a necessity for readers, and the power of selection more and more a desperate problem for the busy part of readers. The possibility of selecting wisely is becoming continually more hopeless as the necessity for selection is becoming continually more pressing.»

... tying in w/ what we were saying (in regards to Harry Crosby) about trading self-indulgence in for self-criticism. Curbing our own selection rather than just fucking wanton—not just in terms of making babies but making art. In becoming our own worst critics, our own editors, our taste testers when making soup (last night it was pozole w/ of course plenty garlic + also Hatch green chilies also sourced from New Mexico (this year's crop is dope, yo). Of being accountable for our own genetic selection + self-terminating the bloodline if deemed necessary.

7.11> We've had this image on our desktop for a while now, waiting for the right time to fit it into a post ... now seems a good a time as any

Snow on a Tree (1970). by Monogramista T.D.Bratislava

This is us tonguing our genetics ... ticking like a cherry bomb ... birfurcating ecstatically. To each his own harmonic carrier frequency. Wandering pilgrims searching for the golden fur, guided by Fibonacci. Our language derived from the river-ruined landscape ... our wells depleted. Genographic data shows where + when, from there we connect the dots. Licking eachother in line ... grooming not just to keep clean but for social reasons. Fuck tweeters. Slipping in + out of the slipstream of conscious thawed. Induced by the polarities of the maternal + paternal lines. A nomadic shift to re-occupy deterritorialization.

We've also been meaning to mention this article our Twitterless Roman friend sent us ... how Ultraconserved words point to deep language ancestry across Eurasia. ... our tongues inedibly tied to our genealogy. The less we use it, the more it mutates. Use them or lose them. They found that there are «words likely to show deep ancestry among languages and even among language families whose relationships might extend well beyond 10,000 years» ... beyond that even, they postulate a «linguistic superfamily that evolved from a common ancestor around 15,000 years ago. We derive a dated phylogenetic tree of this proposed superfamily with a time-depth of 14,450 years, implying that some frequently used words have been retained in related forms since the end of the last ice age.»

... + did u know Project Gutenberg has kindly posted the Etext of the X Chromosome which they say is by the Human Genome Project, but who really is the author? here's the opening excerpt for your reading pleasure ...

>chrX
GGTTTCACCATGTTGGCCAGGCTGGCCTCGAACTCCTGACCTCAGGTGAT CCGCCTGCCTCAGCCTCCTAAAGTGCTGGGATTACAGGCGTGAGCCACCA CACCCGGCCCCAGATCCCTGTCTTGAGACATAACCTACAAGGTGATAGTG TTAAGAGGTGGAGCCCTTTAAGACGTGATGAGGTCATGAGGGTGGGGCCT CAGGAATGAGATGAGTGTCCTTCTAAAAGGGACCCCAGAGAGCTCCCTCG ACCCTTCTGCCACGTGATGACAAGAGTGAGAAGGCACCGTCTGTGAACCA GGAAGCAGGTCCTCACCAGACACTGAACGTGGCATGCTTTGATCTTGGAC TTCTAGCCTCCAGAAGTGTGAGCCTGACCAACAGGGAGAAACCCCGTCTA TACTAAAAATACAAAATTAGCTGGGCATGGTGGCGCATGCCTGTAATCCC AGCTACTCAGGAGGCTGAGGCAGGAGAATCGCTTGAACCCAGAGGGCAGA GGTTGTGGTGAGCCGAGATCACACCATTGCACTCCAGCCTGGGCAACAAG AGGGAAACTCTGCCTCAAAAAAATAAAAATGAAAAAAATAAAGAGGCAAA AGAGCCAGAAGCAAAATGTGCATCCGCCTATTTCCCCTGAGGGCACGTAC GTTCCCTAAGAGCGACAGGTAGAGTGACTAAAAGCACCTTTGTTCCAACA GTGGCAGGCTGTAGCATCCCCGTTCTCAGGAAGCCACAACCAAAAAAAAA AAAAAAAAAAAAAAGCCAGCAACACACATGAGGTGAGAAGGATTTTCCTG AAAACTTCCAGCCTGACAGGTGCATGATTATTTTAAAAGCAGAGCCTAAA TGTGCAAATCTGCAGGAGGGGTAACATGAAACTAAAACATGGCATTGTTT GCAAGCTACATGGCTTCGTAGGAAAGTCTGCTGTATGGGGGGCCATGGCT TGCATGGCTGACAGCATCACTTCTCCTGCATAGTGCAAAACATGGACAAA AAGATGCCTGAAGAGGTCCTGTGGGCCTGCCTAGACTCATCTGGCTTAAT TACAATATTCAGAAATGCAACACCTACTCTCTGGAGAAGTATTCCATTCC CTCTTTCTGGGCTCCCACAAGCACAGTCTTTGCTTGGCTGAGCCAAGGGA GCTGACAGCAAAATCCCTGAGTCTTCGGATATTAGGGCTGTTGTTAGCTA TGGAAGGAGGGCAGAGTTGAGGGTGTCAGACTTGGCCAACCTACCCACCA GAAGGAGGACATGCAAGCCACAGAGACTTGGGAGGAAGGACACAGAACAG TCCACAGATAGTCAAGTAGAGCAAGATTGTTTCAGGAAAAGGGGTTGGTT CTTTCACAGAATCCATGAACAGCAATCATTACCATTTTCATAATCATCAC TATCACCACCATCACCAACATCATAGCCACCACCATCATCATTACCATCA

Another update to the last post ... altho we missed it on our 1st Maphatting pass, yesterday while walking (as we are wont to do) from west 125th to mid 46th we stopped off at 67th to see the Hotel des Artistes ... where the black sunny Harry Crosby murdered his fire princess + then shot himself. Only had my not-so-smart phone on me, so didn't get a good photo, but it's an intresting bldg.

where Harry Crosby's murder-suicide went down

... i mean, we've noticed it before in passing, but things are different w/ the knowledge in mind of what transpired there.

+ speaking of fathering, we've probly seen Godfather I + II more than 20 times a piece ... yet we finally watched Godfather III for the 1st time last night ... as xpected w/ regret.

We don't talk much about what we watch here ... usually we consider it just mindless entertainment. Lately, Les Revenants, a French zombie series. Before that, The Boss. Been on an Ingmar Bergman kick lately, re-watching + watching his films ... before we realized they're kind of boring. Also recently re-watched Roy Andersson's films ... to get psyched for his forthcoming Pigeon Sat on a Branch Reflecting on Existence ... Man skulle kunna tro att vi skulle ha plockat upp några svenska av nu.

Listening to the new Horse Lords, for those mathematically inclined. + speaking of, our next post will be from Baltimore (where the Horse Lords lord from).

A Short History of Decay by E.M. Cioran amidst autumnal decay

Reading A Short History of Decay by E.M. Cioran ... case you couldn't tell by this post's epigraph. More cynical + despair-ridden ditties from the quintessential nihilist hell-bent on flushing out the hypocrisies of the human condition. Surely Herzog must've read him plenty.

He continues what he started w/ The Trouble with Being Born (which we talked about here) ... tho actually A Short History of Decay is his 1st book. It doesn't matter w/ Cioran, there is no chronology. He's too pessimistic to even start a thread, to develop a theory or school of thought. From the beginning he was aware of the innate hypocrisy inherent in the human condition. Each thought annihilates itself before even getting off the ground, a message ever self-destructing. It's the kind of book that in talking about it it's just better to quote him ... + then u want to quote each passage + each page ... before it explosively self-destructs in your hands ... may as well just put quotes around the whole book + let it speak for itself. But here's some passages that stood out for us in our current state of mind:

«Nothing can change our life but the gradual insinuation within us of the forces which annihilate it. No new principle comes to it from the surprises of our growth nor from the efflorescence of our gifts; they are merely natural to it. And nothing natural can make us anything but ourselves.»

«There is only the artist whose lie is not a total one, for he invents only himself. Outside of the surrender to the incommunicable, the suspension amid our mute and unconsoled anxieties, life is merely a fracas on an unmapped terrain, and the universe a geometry stricken with epilepsy.»

«Reason vainly strives to show us the infinitesimal proportions of our disasters; it fails, confronted with our penchant for cosmogonic proliferation. Thus true madness is never due to chance or to the disasters of the brain, but to the false conception of space the heart creates for itself ...»

+ rather than transcribe it, here's all of page 25:

... + we've only gotten thru the Directions for Decomposition section. Of particular note is how much he uses the words heart + blush.

+ also it seems decadence must derive from decay—something that never occurred to us before now ... sheds some light on the decadence of Harry Crosby. His debaucherous self-indulgence was at the expense of the rest of the system ... u could perhaps say his enlightenment inevitably led to moral decay ... not just in him, but in the rest of the system he touched, for no 1—specially Crosby—is isolated from the system.

+ speaking of nihilists + «double-suicide or it wasn't love» ... also recently read Gil the Nihilist by Sean Kilpatrick ... + also just posted this piece by him on Sleepingfish.

9.11> In pursuit of Maphattan, yesterday we did 6 streets ... 51st thru 46th ... in the thick of the most annoyingly touristic areas ... thru Rockefeller Center + starting to get into the heart of Time Square ... some 12 miles + considering the evening before we walked (again) from west Harlem to mid-town east, that makes 20+ miles in less than a 24 hour period.

 

Rock-a-fella

 

Radio City

 

St. Patrick's behind shrouded in scaffolding (like much of NYC)

 

St Bartholomew's (kicks St Patrick's ass in our opinion)

There's probly lots to take photos of in these touristic areas—since plenty of people are «sight-seeing»—we just couldn't bring ourselves to «take» much. Sure there are plenty of Rockefeller/Times Square photos already gracing your pages, dear Internet. Passed some lesser-known landmarks, like Steinbeck's rowhome on E 51st where he wrote Cannery Row, Katherine Hepburn's digs on E 49th + Bob Dylan rented the house next door ... here's a letter he wrote to her:

Also passed where Truman Capote + Johnny Carson lived at 860-870 UN Plaza (strangely in the same building we went to to get our Kenyan visas before we moved there) + we went to 440 E. 51st where supposedly Peggy Guggenheim + Max Ernst shacked up ... but couldn't find the address or they changed the numbers, likely it was the swanky house on the river. But here's the entryway of the house across the street.

435 E. 51st

Also tried to find where Andy Warhol's original Factory was (231 E. 47th street) but guess it's been torn down + replaced w/ some ugly apartment building (what prompted Warhol to leave). Passed the Brill bldg on 1619 Broadway, where a bunch of singer-songwriters used to work, including Phil Spector, but it also is shrouded in scaffolding + mobbed w/ tourists ... not like we didn't used to pass it all the time when we worked (gasp!) in Times Square ... in the MTV bldg, which we likely also passed but by this time we were running in the road w/ the honking limos + taxis just to get thru the throngs of tourists.

our favorite sign in NYC ... not that we're fans of the hotel

 

1 of our favorite buildings (GE) ... tho this pic doesn't capture the essence

 

UN

 

awning

On 49th street we got swept up in an Indian wedding ... complete w/ a white horse ... only in NYC.

Punjab wedding

 

Stopped + got tacos at the Tehuitzingo bodega in Hell's Kitchen.

 

Scientology + Rock of Ages hand in hand

 

diamond district (47th)

 

where the enemy (big publishing) lives

 

gets a bit more gritty on the west west side ...

 

sadly where the carriage horses live, along with cats to keep the oats-eating mice at bay

 

also where the hot dog carts sleep

Back to Cioran ... this quote (from the Faces of Decadence section) intresting in light of the idiocy of Mid-town + also, again, shedding light on the decadent decay-dance of Harry Crosby:

«A nation cannot create indefinitely. It is called upon to give expression and meaning to a sum of values which are exhausted with the soul which has begotten them. The citizen wakens from a productive hypnosis; the reigns of lucidity begins; the masses wield no more than empty categories. Myths turn back into concepts: that is decadence. And the consequences make themselves felt: the individual wants to live, he converts life into finality, he elevates himself to the rank of minor exception. The ledger of these exceptions, constituting the deficit of a civilization, prefigures its effacement. Everyone achieves delicacy—but is it not the radiant stupidity of the dolts which accomplishes the work of the great periods.»

+ a few pages later:

«The mistake of those who apprehend decadence is to try to oppose it whereas it must be encouraged: by developing it exhausts itself and permits the advent of other forms. The true harbinger is not the man who offers a system when no one wants it, but rather the man who precipitates Chaos, its agent and incense-bearer.»

Rare few have achieved such insight + lucidity in prose as Cioran. + while his message may seem cynical + negative , it is only an accurate reflection of the world, which is evil + chaotic ... even more exhausted + maxed out now than it was a century ago. Cioran's response is 1 of inner composure in the face of bedlam, to embrace the exhaustion + let it pacify, to quit propagating our soured blood + elevate toward a sort of sagehood ... at the risk of being perceived as a monster (like us):

«Having exhausted his appetites, the man who approaches a limit-form of detachment no longer wants to perpetuate himself; he loathes surviving in someone else, to whom moreover he has nothing more to transmit; the species appalls him; he is a monster—and monsters do not beget. "Love" still holds him prisoner: an aberration among his thoughts. In love he seeks an excuse to return to the common condition; but the child seems as inconceivable to him as the family, as heredity, as the laws of nature. With neither profession nor lineage, he achieves—final hypostasis—his own conclusion.»

He continues this thread on saints, climaxing w/ Teresa .. «Bernini has shown us the quality of their secrets in his statue of the Spanish saint in Rome, where Teresa incites us to so many considerations as to the ambiguity of her swoons. ...» Tho we'd argue Bernini's rendition of the ecstasy of Ludovica Albertoni is even more exemplary of this condition + hardly any tourists know about it (it's in the San Francesco a Ripa church, a few blocks from where we used to live in Trastevere).

Bernini's statue of Ludovica Albertoni in throes of death/ecstasy (u decide)

 > 388 > By reflexing the rebar-red Wire city we track direct current ALT covering GND


5cense

[  (ɔ)om.Posted 2014  derek white  |  calamari press   ]